BP914474 | |
Clone id | YMU001_000059_C11 |
Library | YMU01 |
Length | 492 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000059_C11. |
Accession | BP914474 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL2234Contig1 |
Sequence | CATAGACATTGTGGATGGAGATAAACCCACTGCCGAAGAGTTTTTAGAGAATCTATCGAA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | O95256 |
Definition | sp|O95256|I18RA_HUMAN Interleukin-18 receptor accessory protein OS=Homo sapiens |
Align length | 75 |
Score (bit) | 30.8 |
E-value | 3.5 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A9NPY3 |
Definition | tr|A9NPY3|A9NPY3_PICSI Putative uncharacterized protein OS=Picea sitchensis |
Align length | 43 |
Score (bit) | 58.9 |
E-value | 1.0e-07 |
Report | BLASTX 2.2.19 [Nov-02-2008] |