BP914467 | |
Clone id | YMU001_000059_C03 |
Library | YMU01 |
Length | 510 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000059_C03. |
Accession | BP914467 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | CTGGAAGAATTTGCGGCCGCGAATTCTTCGAGTTAGATTCAAGTCGTACACAACTGGGCC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q5VT52 |
Definition | sp|Q5VT52|RPRD2_HUMAN Regulation of nuclear pre-mRNA domain-containing protein 2 OS=Homo sapiens |
Align length | 27 |
Score (bit) | 29.3 |
E-value | 9.8 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A7P6K6 |
Definition | tr|A7P6K6|A7P6K6_VITVI Chromosome chr9 scaffold_7, whole genome shotgun sequence OS=Vitis vinifera |
Align length | 23 |
Score (bit) | 44.3 |
E-value | 0.003 |
Report | BLASTX 2.2.19 [Nov-02-2008] |