BP913029 |
Clone id |
YMU001_000025_F04 |
Library |
YMU01 |
Length |
47 |
Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000025_F04. |
Accession |
BP913029 |
Tissue type |
prothallium |
Developmental stage |
- |
Contig ID |
- |
Sequence |
CTAATGTCTGTTAAAGTTGTATTGGAACAGGCATAGGAGCTATTCGG |
■■Homology search results ■■ |
- |
Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot(No blast op. Sequence too short.) |
sp_hit_id |
- |
Definition |
- |
Align length |
- |
Score (bit) |
- |
E-value |
- |
Report |
- |
TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL(No blast op. Sequence too short.) |
tr_hit_id |
- |
Definition |
- |
Align length |
- |
Score (bit) |
- |
E-value |
- |
Report |
- |