BP912350 | |
Clone id | YMU001_000018_A12 |
Library | YMU01 |
Length | 515 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000018_A12. |
Accession | BP912350 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | GAAGAATTCGCGGCCGCAGGAATTGATTGTATCAGAGGTGAGTAATCTTCTTCATCATGG |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q2QI47 |
Definition | sp|Q2QI47|USH2A_MOUSE Usherin OS=Mus musculus |
Align length | 43 |
Score (bit) | 30.4 |
E-value | 4.5 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q73YW4 |
Definition | tr|Q73YW4|Q73YW4_MYCPA Putative uncharacterized protein OS=Mycobacterium paratuberculosis |
Align length | 38 |
Score (bit) | 35.0 |
E-value | 1.9 |
Report | BLASTX 2.2.19 [Nov-02-2008] |